Multivariate analyses were carried out more generally in the framework of additive log-linear Cox and logistic models. Odds ratios fda approved were estimated by using conditional maximum likelihood. Survival functions were estimated by using a Kaplan-Meier estimator (Cox DR, Snell EJ: Analysis of Binary Data. Capman & Hall/CRC, 1989; Klabfleisch JD, Prentice RL: The Statistical Analysis of Failure Time Data. John Wiley & Sons, 2002). Statistical analysis was performed by statisticians at the Cancer and Leukemia Group B (CALGB) Statistical Center by using the R statistical environment (version 2.6.1; R Foundation for Statistical Computing, University of Auckland, Auckland, New Zealand; R Development Core Team: A language and environment for statistical computing, 2007. http://www.r-project.org/).
Patients were registered and were randomly assigned to the treatment trial, and clinical data were collected and managed by the Southwest Oncology Group Statistical Center. Tumor samples were received and managed by the CALGB Pathology Coordinating Office. All data were frozen on September 14, 2006. Table A1. Primer and D-HPLC Conditions Used for KIT and PDGFRA Genotyping Studies Exon Forward Primer Reverse Primer D-HPLC Temperatures (��C) K8 GCTGAGGTTTTCCAGCACTC AATTGCAGTCCTTCCCCTCT 50.0 K9 ATGCTCTGCTTCTGTACTGCC CAGAGCCTAAACATCCCCTTA 50.0 K11 CCAGAGTGCTCTAATGACTG ACCCAAAAAGGTGACATGGA 50.0/56.2 K13 CATCAGTTTGCCAGTTGTGC ACACGGCTTTACCTCCAATG 59.5 K17 TGTATTCACAGAGACTTGGC GGATTTACATTATGAAAGTCACAGG 58.0 P12 TCCAGTCACTGTGCTGCTTC GCAAGGGAAAAGGGAGTCTT 50.0/59.7 P14 TGGTAGCTCAGCTGGACTGAT GGGATGGAGAGTGGAGGATT 59.
1 P18 ACCATGGATCAGCCAGTCTT TGAAGGAGGATGAGCCTGAC 50/61.6 View it in a separate window Abbreviation: D-HPLC, denaturing high-performance liquid chromatography. Table A2. Correlation of Imatinib Dose, GIST Genotype, and Objective Response Rate Genotype Imatinib Dose (%) Analysis 400 mg 800 mg OR 95% CI P KIT exon 9 17 67 9.05 1.24 to 116.74 .02 KIT exon 11 71 72 1.05 0.59 to 1.90 .89 WT 42 50 1.39 0.40 to 4.83 .59 View it in a separate window NOTE. Objective response rate includes complete response and partial response rates. Abbreviations: GIST, gastrointestinal stromal tumor; OR, odds ratio; WT, wild type. Table A3. Univariate and Multivariate Analysis of Cofactors Associated With TTP Cofactor Analysis of Progression-Free Survival Univariate Multivariate P HR 95% CI P HR 95% CI KIT mutation Exon 9 .
0022 1.82 1.24 to 2.68 .0008 2.07 1.35 to 3.16 WT .0051 1.53 1.14 to 2.06 .0002 1.85 1.34 to 2.56 Treatment* .69 1.05 0.83 to 1.32 .18 1.18 0.93 to 1.50 Sex, male .06 1.25 0.99 to 1.57 .007 1.41 1.10 to 1.82 Age, by decades .78 0.99 0.90 to 1.08 .74 1.02 0.93 to 1.11 Zubrod performance? 1.6 �� 10?6 2.14 Entinostat 1.57 to 2.92 8.1 �� 10?5 2.02 1.42 to 2.87 ANC .0061 1.07 1.02 to 1.12 .10 1.