LOXIN forms heterodimers with LOX-1, preventing cell surface localization and function [14] and [15]. To examine the consequence of selective endothelial expression of LOX-1 in atherosclerosis, we used adenoviral gene transfer of LOX-1 in the common carotid artery. We found that overexpression of LOX-1 enhances atherogenesis and that LOXIN inhibits the development of plaque induced by LOX-1 overexpression. Plasmids containing the cDNA for both LOX-1 and

LOXIN were a generous gift from Prof. Giuseppe Novelli. The expression cassette from pCpG-mcs (InvivoGen, San Diego, CA, USA) containing the mCMV enhancer, EF1α promoter, small synthetic intron, and polyA signal was removed by EcoRI digest and cloned into pDC511 (Microbix Biosystems, Canada). The cDNAs for LOX-1 and LOXIN were amplified by PCR using KOD proofreading polymerase with primers SW187F 5′ GCGCAGGCCTCCCGCCATGACTTTTGATGACC, which created a StuI restriction site and optimized the KOZAK Selleckchem Akt inhibitor sequence, and SW188R 5′ CGGCGCTAGCTAAAATGCAGTTTTC, which created a NheI restriction http://www.selleckchem.com/products/BKM-120.html site. The NcoI site within the multiple cloning site of the expression

cassette was removed by digestion, blunting, and relegation, and the amplified cDNAs for LOX-1 and LOXIN cloned in StuI/NheI. Adenoviral vectors were produced using the Microbix Biosystems kit according to their protocols. RAd66 [16], an Ad-null empty virus, was used to control for virus-induced inflammation. All experiments were performed according to home office guidelines and approved by the local ethics committee for animal experimentation. Eight-week-old female ApoE−/− mice were placed on high-fat diet (containing 21% lard and 0.15% cholesterol) 4 weeks prior to gene delivery, to induce hypercholesterolemia and then maintained on high-fat diet for the remainder of the experiment (n=6 per group). Adenoviral

transduction of carotid arteries was performed by luminal incubation of each vector for 10 min without silastic collar placement as described [17] (see Supplementary Information). Viruses were diluted to 1×1010 why pfu/ml using the dialysis buffer used to prepare the adenoviral vector stocks [10 mM Tris (pH 7.5), 135 mM NaCl, 1 mM MgCl2, 10% v/v glycerol], to ensure that all transductions were performed under the same conditions, the vehicle control just contained dialysis buffer. For investigating the effects of LOXIN on LOX-1-induced atherogenesis, 1×1010 pfu/ml of each vector was used (total 2×1010 pfu/ml); hence 2×1010 pfu/ml of the control virus RAd66 was used as a control for this group (labelled RAd66 high). Six weeks following transduction, mice were sacrificed and perfusion fixed with 4% formaldehyde for 5 min. The carotids were exposed, cut longitudinally, and excised before being pinned out flat and fixed for a further 24 h. The fixed arteries were then immobilized in agar, processed, and paraffin embedded so that longitudinal sections of the carotids could be cut.