Specificity of amplification products was assessed by melting curve analysis. Relative M2 and AchE gene expressions were quantified using the 2?����Ct method [18]. M2 receptor gene sequencing selleck catalog Genomic DNAs from normal and vagal hyperreactive rabbits were isolated from peripheral blood cells using Qiagen technology (GmbH, Hilden, Germany) and quantified by spectrophotometry. Exon of the cholinergic muscarinic M2 receptor gene (rabbit CHRM2, Ensembl genome database) was amplified using specific primers (forward 5��GGCAGGAATGATGATTGCAGC3�� and reverse 5��AGCTAGTTGGGTCTTCAGGTC3��). All amplification reactions were performed on a Mastercycler epgradient 5 (Eppendorf, France) using a Taq DNA polymerase from Sigma (Sigma-Aldrich, Saint-Quentin, France), 1.
5 mM MgCl2 and 500 nM of each primer in a PCR buffer (Sigma-Aldrich, Saint-Quentin, France) under the following cycling conditions: 94��C for 5 min, followed by 35 cycles of 30 s at 94��C, 20 s at 58��C, 15 s at 72��C. Quality of the amplification products was checked by gel electrophoresis. After amplification, PCR products were purified on QIAquick columns (Qiagen) and processed on an AB 3100 genetic analyzer (Applied Biosystems, CA). After the sequencing step, extension products were size-fractionated by capillary electrophoresis and sequences were compared to the M2 receptor gene reference sequence from the Ensembl genome database using SeqScape (Applied Biosystems, CA) and BioEdit (Ibis Therapeutics, CA) softwares. AchE enzyme activity AchE enzyme activity was measured in erythrocytes from venous total blood samples collected on heparin according to an enzymatic colorimetric assay as previously described [19].
Ethics statement All the methods employed in this work are in accordance with the French law concerning experimentations on vertebrate laboratory animals (D��cret 2001-464 from May 29, 2001 as a revision of the D��cret 87-848, 1987) and according to European guidelines. PB, JF and JPG hold personal agreements from the Direction des Services V��t��rinaires du Bas-Rhin, Agriculture Ministery, France (authorization numbers 67�C249 to PB, 67-2010 to JF and 67�C87 to JPG) which cover the protocols followed in the present study. Statistics All values are expressed as mean �� standard deviation (SD). SD values were preferred to SEM since they better reflect variabilities of the measured parameters than SEM values.
Unpaired t-tests were performed using the Mann-Whitney U test. P values < 0.05 were considered to be statistically Drug_discovery significant. Results Haemodynamic effects of the standard dose of phenylephrine The severity of vagal pauses was evaluated in conscious animals by measuring the duration of the R-R interval on ECG recording after intravenous injection of a standard dose of phenylephrine (PNE; 500 ��g kg?1).