We found that host heat shock proteins Hsp70 and Hsp90 are required for RCNMV RNA replication and that they interact with p27, a virus-encoded component

of the 480-kDa replicase complex, on the endoplasmic reticulum membrane. Using a cell-free viral translation/replication system in combination with specific inhibitors of Hsp70 and Hsp90, we found that inhibition of p27-Hsp70 interaction inhibits the formation of the 480-kDa complex but instead induces the accumulation of large complexes that are nonfunctional in viral RNA synthesis. In see more contrast, inhibition of p27-Hsp90 interaction did not induce such large complexes but rendered p27 incapable of binding to a specific viral RNA element, which is a critical step for the assembly of the 480-kDa replicase complex and viral RNA replication. Together, our results suggest that Hsp70 and Hsp90 regulate different steps in the assembly of the RCNMV replicase complex.”
“The h5-HT7 receptor is subject to inactivation by risperidone and 9-OH-risperidone, apparently through a pseudo-irreversible complex

formed between these drugs and the receptor. Although risperidone and 9-OH-risperidone (“”inactivating antagonists”") completely inactivate the receptor, only 50% of the receptors form a pseudo-irreversible complex with these drugs.

This study aims to more fully determine the mechanism(s) responsible for the novel effects of risperidone and 9-OH-risperidone and to determine if the inactivation can be reversed (reactivation).

The ability of non-inactivating drugs (competitive antagonists) to dissociate wash-resistant [H-3]risperidone selleckchem binding from h5-HT7 receptors was investigated. second Also, the ability of non-inactivating drugs to reactivate inactivated h5-HT7 receptors was investigated, using cAMP accumulation as a functional endpoint.

The competitive (non-inactivating) antagonists clozapine and mesulergine released the wash-resistant [H-3]risperidone binding to the h5-HT7 receptor. The competitive antagonists clozapine, SB269970, mianserin, cyproheptadine, mesulergine, and ICI169369 reactivated the risperidone-inactivated h5-HT7 receptors in a concentration-dependent

manner. The potencies for reactivation closely match the affinities of these drugs for the h5-HT7 receptor (r (2) = 0.95), indicating that the reactivating antagonists are binding to and producing their effects through the orthosteric binding site of the h5-HT7 receptor. Bioluminescence resonance energy transfer analyses indicate that the h5-HT7 receptor forms homodimers.

The ability of the non-inactivating drugs to bind h5-HT7 orthosteric sites and reverse the wash-resistant effects of risperidone or 9-OH-risperidone, also bound to h5-HT7 orthosteric sites, is evidence for protomer-protomer interactions between h5-HT7 homodimers. This is the first demonstration of a non-mutated G-protein-coupled receptor homodimer engaging in protomer-protomer interactions in an intact cell preparation.

)”
“Chronic opiate administration alters the expression levels of the stress-responsive peptide, corticotropin-releasing factor (CRF), in the bed nucleus of the stria terminalis (BNST). This brain region contains CRF receptors that drive

drug-seeking click here behavior exacerbated by stress. We used electron microscopy to quantitatively compare immunolabelling of the corticotropin-releasing factor receptor (CRFr) and CRF in the anterolateral bed nucleus of the stria terminalis (BSTal) of mice injected with saline or morphine in escalating doses for 14 days. We also compared the results with those in non-injected control mice. The tissue was processed for CRFr immunogold and CRF immunoperoxidase labeling. The non-injected controls had a significantly lower plasmalemmal density of CRFr immunogold particles in dendrites compared with mice receiving saline, but not those receiving morphine, injections. Compared with saline, however, mice receiving chronic morphine showed a significantly lower plasmalemmal, and greater cytoplasmic, learn more density of CRFr immunogold in dendrites. Within the cytoplasmic compartment of somata and dendrites of the BSTal, the proportion of CRFr gold particles associated with mitochondria was three times

as great in mice receiving morphine compared with saline. This subcellular distribution is consistent with morphine,- and CRFr-associated modulation of intracellular calcium release or oxidative stress. The between-group changes occurred without effect on the total number of dendritic CRFr immunogold particles, suggesting that chronic morphine enhances internalization or decreases delivery of the CRFr to the plasma membrane, a trafficking effect that is also affected by the stress of daily injections. In contrast, saline and morphine treatment groups showed no significant differences in the total number of CRF-immunoreactive axon terminals, or the frequency with during which these terminals contacted CRFr-containing dendrites. This suggests that morphine does not influence axonal availability of CRF in the BSTal. The results have important implications

for drug-associated adaptations in brain stress systems that may contribute to the motivation to continue drug use during dependence. (C) 2009 IBRO. Published by Elsevier Ltd. All rights reserved.”
“Background: U.S. black and Hispanic populations are growing at a steady pace. In contrast, the medical profession lacks the same minority growth and representation. Women are also under-represented in many surgical disciplines. The purpose of this study was to assess trends in the proportion of women, blacks, and Hispanics admitted to vascular surgery (VS) and related specialties, and to compare them with each other and with a surgical specialty, orthopedic surgery (OS), with a formal diversity initiative.

This gene has a nearly identical homolog in C. immitis, CIMG_03142, that was upregulated 3.6 fold in day 2 spherules and 3.39 fold in day 8 spherules. Whiston et al. also found it to be upregulated in spherules [13]. Another H. capsulatum gene that is required for yeast formation is α glucan synthase (AGS1) gene [62]. This enzyme catalyzes the production of α (1,3) glucan in the cell wall that obscures the β (1,3) glucan and prevents activation of innate immunity via the dectin-1 receptor [62]. C. immitis has an AGS1 gene (CIMG_13256) that was upregulated in the day 8 spherule (2.48 fold) but not day 2 spherules. Whiston et al. found this gene to be upregulated

1.93 fold in spherules compared to mycelia [13]. There is no literature describing the relative amounts of α (1,3) glucan and β (1,3) glucan in C. immitis mycelia or spherules. We know, however, that there is enough Selleck Enzalutamide exposed β (1,3) glucan buy MM-102 in Coccidioides spherules to stimulate macrophages to produce cytokines via dectin-1 [63]. Two genes selleck chemical coding for transcription factors, Ryp2 and Ryp3, have been found to be essential for conversion from filaments to yeast in H. capsulatum[64]. These genes are overexpressed in the yeast phase of H. capsulatum[64]. C. immitis has nearly identical homologs of these genes but they were not overexpressed

in either day 2 or day 8 spherules, suggesting that they may not be required for the transformation from mycelium to spherule. Gene disruption experiments in B. dermatitidis have shown that a histidine kinase, DRK1, is required for the transformation from filaments to yeast [65]. It is not clear from the literature whether or not this gene is overexpressed in the B. dermatitidis yeast phase. C. immitis has a very closely related homolog of this gene (CIMG_04512) but it was not up or down regulated in day 2 or day 8 spherules. In another dimorphic pathogenic fungus, S. schenckii, the calcium/calmodulin kinase I gene (SSMK1) was found to be required for formation of yeast [53]. There are two genes in C. immitis that are highly homologous to the S. schenckii SSMK1 gene; neither

one of these was up- or downregulated in day 2 or day 8 spherules. A number of studies have been done studying the transcriptome of P. brasiliensis[66, 67]. One study identified Amobarbital the 4-HPPD gene to be required for P. brasiliensis conidia to convert to yeast [66]. They found that the 4-HPPD gene expression was upregulated in the yeast form and that a biochemical inhibitor of this enzyme, nitisinone, inhibited mycelium conversion to yeast. 4-HPPD (E.C. 1.13.1127) is an enzyme that converts 4-hydroxyphenylpyruvate to homogentisate that is involved in the synthesis of tyrosine, phenylalanine, and ubiqinone (KEGG, whttp://​www.​genome.​jp/​keg). There are two homologs of the 4-HPPD in the C. immitis genome, which have significantly different sequences.

2007). In part, this discrepancy may be explained by the fact that our questionnaire only asked about formal sources of information and did not evaluate their importance relative to other sources of information.

Among sources of information we asked about, peer-reviewed publications and synthetic reviews were perceived as the most important and available (Fig. 1). We suggest that ecologists should not underestimate GSK621 purchase the importance of publishing their results and contributing to conservation plans, white papers, and other printed materials that can guide habitat conservation and conservation. However, as the volume of this information grows, so does the need for well-organized clearinghouses that make this information available to a wide audience (Kondolf et al. 2007). Akt inhibitor Web-based tools are not yet important or widely available The relatively recent development of sophisticated, interactive web-based applications has introduced

an entirely new medium for providing information to managers and policy makers. However, despite the enormous potential of these tools, our survey results suggest that for riparian habitat conservation in California, they are not yet perceived as important or available. We do not suggest that web-based tools should not be BAY 11-7082 concentration developed. Indeed, we agree that making information available on the internet will have

many positive outcomes for conservation and restoration ecology (Jenkinson et al. 2005). However, our results suggest that simply making these tools available on the web will not be effective. To increase the utility of these tools, ecologists will need to engage with decision Sodium butyrate makers to provide the training they need to effectively use the tools. Ultimately, the utility of online applications may not be that they provide a single tool, but that they provide managers with access to a dynamic collection of tools. Such “decision support systems” could be designed to provide managers with access to a library of electronic versions of traditional printed documents and site-specific data dynamically displayed with custom visualizations. In North America, the Avian Knowledge Network (http://​www.​avianknowledge.​net) fosters the development of such systems through its distributed nodes, such as PRBO’s California Avian Data Center (http://​www.​prbo.​org/​data) and Bird Study Canada’s Nature Counts (http://​www.​birdscanada.​org/​birdmon/​default/​) (G. Ballard, pers. comm.). One-on-one interactions are important, but not available Respondents from all professional affiliations agreed that one-on-one interactions with ecologists who develop information to support decisions are important, but not widely available (Fig. 1).

In addition, microscopic examination for diagnosis of anaplasmosis and babesiosis is both time-consuming and labor intensive making them quite expensive. Hence, there is a desperate need to develop efficient tests for detection of the presence of these pathogens in a cost-effective and efficient manner. The presence of nucleases in serum and in other body fluids ensures clearance of nucleic acids when pathogens are eliminated by treatment with antimicrobials [50, 75, 76]. Therefore, nucleic acid based tests are now becoming

popular for diagnosis of various infectious diseases [51, 52, 77]. Indeed, these assays are ideal as the tests of cure for various diseases. Early selleck inhibitor detection of infection by Borrelia species, A. phagocytophilum and Babesia species using nucleic acid based techniques can lead to successful treatment of the illnesses in a timely manner. We previously developed a sensitive and accurate quantitative selleck kinase inhibitor real-time PCR assay using molecular beacons for mouse tissues [61]. MassTag PCR has been employed to detect coinfection of ticks collected from different sites in New York with B. burgdorferi, A. phagocytophilum and B. microti[6, 78] and quantitative PCR has also been employed recently for patient samples [79]. A pilot study, using the patient blood samples used multi-locus PCR and electrospray ionization

mass spectrometry, showed 90% efficiency in detection of early Lyme disease and could often distinguish pentoxifylline different strains/genotypes involved [80]. Recently, a real-time PCR test using 18S rRNA gene of B. microti was successfully used by employing SU5402 mouse small DNA groove probe for specific detection of the presence of this parasite with a sensitivity

of ~100 gene copies per 5 μl of the patients’ blood [53]. However, all these tests have yet to be fully refined to employ them for diagnosis purpose in a cost-effective manner. In this study, we have expanded the use of specific molecular beacon probes in real-time PCR for either simultaneous detection of three Lyme spirochete species and distinguishing them using the denaturation profile analysis or detection of the presence of A. phagocytophilum and B. microti along with B. burgdorferi in the sample using a single assay. Use of our duplex versus a multiplex assay according to need will be efficient and less expensive assay for diagnosis of multiple tick-borne diseases. Our optimized multiplex assay could accurately detect and quantify a single spirochete recA gene copy spiked in the human DNA. The presence of high concentrations of human genomic DNA (containing 105 copies of ACTA1 gene) did not affect accuracy of the assay (Figure 2) as also shown by almost perfect coefficient of correlation (r2 = 0.999) between threshold cycle and copy number of B. burgdorferi DNA. In addition, an asymmetric PCR was able to detect B. burgdorferi, B. afzelii and B.

The cultures were incubated at 30°C with vigorous shaking (250 rpm). When the cultures reached mid-logarithmic phase, the cells were collected by centrifugation and flash frozen in liquid nitrogen. Cells were stored at -80°C prior to RNA extraction. For exogenous expression of Fur and RyhB, the fur and ryhB open reading frames (ORFs) were PCR amplified with primers fur-F1 and fur-R1, and ryhB-F1 and ryhB-R1, respectively (Table 2). The PCR products were digested with SalI and EcoRI, and cloned into the broad-range expression vector pBBR1MCS5-1 (Kmr), placing the ORFs under the transcriptional control of a strong lac promoter.

The resulting plasmids were verified by DNA sequencing and transferred into E. coli

WM3064, which is a diaminopimelic acid (DAP) auxotroph with plasmid RK4 integrated in the chromosome to mobilize plasmid in trans during conjugation [37]. Conjugation www.selleckchem.com/products/empagliflozin-bi10773.html was carried out by mating E. coli and S. oneidensis in 1:1 donor/recipient ratio for 8 hrs on a LB/DAP plate at 30°C followed by selection of S. oneidensis transconjugants on LB agar plates supplemented with 50 μg/ml kanamycin. The vector pBBR1MCS5-1 was also transformed into S. oneidensis for the purpose PF299804 cell line of comparison. Table 2 Oligonucleotide primers used in this study. Primer name Sequence strain construction   fur-F1 GGTCGACCAAGAGATTAGCAATGACAGATG fur-R1 GGAATTCGAGCAAGCTTATTCGTCGT ryhB-F1 GGTCGACAGGAGGAACTCTGATGACTGGTAATCTG Ruxolitinib mw ryhB-R1 GGAATTCAGTTAAATGTGGCGCAAAC Reverse Transcription-PCR ryhB-F2

TCTGACGTTGTTAAAGTGCTCC ryhB-R2 CCTAATGCGCCTATTCGCT Control 1-F TCAGGTTGTTTGGTATTGTGC check details Control 1-R CCATCAATCAAGGTTGTCG Control 2-F CTGTCAAATGGTGTGCTGC Control 2-R GTGTAACAGTGCTAAAGCCTGC Control 3-F TCTACTCAAATGACGAGCTGC Control 3-R GAAAAGCCGCCAAATGC Control 4-F TATGGTTTCCCGCTTTCG Control 4-R AACGCATCAGTGCTATTTGC Control 5-F TCACTCACAGAACGCTTCG Control 5-R GCAGCTACAGAATGTCACTACG Control 6-F TCTAGCAGGGATTAAATGAGC Control 6-R CCTTCGCCTTGTCTAAAGC 5′- and 3′-RACE assays   5′- RNA adapter GAUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA ryhB-R3 AGAGTGTGTGAGCAATGTCG 3′- RNA adapter UUCACU GUUCUUAGCGGCCGCAUGCUC-idT Quantitative RT-PCR   RyhB-F TCTGACGTTGTTAAAGTGCTCC RyhB-R CCTAATGCGCCTATTCGCT SdhA-F GAGCAGTTAAAAGCCATCC SdhA-R GTTGTCCAATTCTAAACACTCG AcnA-F ACCAACAAACGCTAGACTACC AcnA-R ATCATCGCTCCACAAACC SodB-F TCTACTGGAACTGCTTAGCACC SodB-R TGAATGCATCGAATGAACC RecA-F AACCCAGAAACCACAACG RecA-R ACCAACCACCTCATCACC Primer sequences were derived from the S. oneidensis MR-1 genome sequence [25]. F and R stand for forward and reverse primers, respectively. HPLC analyses S. oneidensis wild-type (strain MR-1) and the fur mutant were grown to mid-logarithmic phase in M1 medium with 10 mM lactate as the sole carbon source.

Most of the PUUV antibody positive voles detected in this work were also PUUV RNA positive (33 out of 37). Among the four that had too low PUUV viral load to be considered RNA positive, one was an immature male.

PUUV antibodies were likely to result from maternal transfer [e.g. [56, 58]]. The three other voles were adults, Ro 61-8048 datasheet and were probably not shedding PUUV at this time. We could however not investigate the reasons underlying these differences in PUUV viral load between PUUV antibody positive adult voles. We used two appropriate methods to detect negative and positive interactions [43]. We reported significant positive associations between two helminth species (H. click here mixtum and A. muris-sylvatici) and PUUV infection in bank voles. Because helminths generally drive strong type 2 responses [59], which are antagonistic to type 1 responses involved in the immune defense against hantaviruses [review in [60]], we addressed the question of whether these helminth infections could influence vole susceptibility to PUUV. First, we found that PUUV infection was more often observed in voles coinfected

with H. mixtum, and that PUUV viral loads were slightly higher in voles coinfected with this nematode. These results can be interpreted with regard to the immune knowledge acquired from the close parasite Nippostrongylus (syn. Heligmosomum) brasiliensis, which is extensively used as a laboratory model to study Th2 immunity. In mice and rats, N. brasiliensis induces polarized Th2 responses characterized by elevation Selleckchem Tideglusib of IgE and Th2 cytokines such as IL-4, IL-5, and IL-13 [e.g. [61, 62]]. This immune response might increase the susceptibility to PUUV. Org 27569 On another hand, Reece et al. [62] also reported that the baseline transcription levels of Th1 cytokines (IFN-γ, IL-12, and IL-6) are also elevated in N. brasiliensis-infected mice. This could explain that the Th2 response induced by

H. mixtum is not strong enough to induce a dramatic increase of PUUV viral loads in coinfected voles. A similar observation had been made by Liesenfeld et al. [45] and Erb et al. [63] on a different biological system. They respectively showed that the densities of Toxoplasma gondii and Mycobacterium bovis in mice were only slightly affected by the presence of N. brasiliensis. Lastly, an added complexity in the interpretation of this coinfection is the possibility that it might be generated by correlated exposure, by parasite longevity and host age, or by differences in the genetic constitution of individual hosts. We can hypothesize that genetic factors of susceptibility might mediate the significant co-occurrence of PUUV and H. mixtum infection. Major histocompatibility complex (Mhc) class II genes could be relevant candidates as their polymorphism seems to influence the risk of PUUV or H. mixtum infection in bank voles [52, 64, 65].

The fact that FCE information is of Entospletinib complementary value increases the intention of future use. Thus, the hypothesis is not rejected that when IPs consider FCE information to be of complementary

value, they APR-246 price will also intend to make use of this information in future disability claim assessments. One explanation for this might be that IPs do not have many instruments upon which to base their judgment when assessing work ability of claimants in the context of disability claims. FCE information is a potential instrument to assist them in this task. IPs in the group that considered the FCE information to be of complementary value, changed their judgment significantly more often as compared to their colleagues with the opposing opinion.

The following remarks may be made with regard to the external validity of the results: 1. In this study, IPs could not directly refer claimants for FCE assessment; moreover, claimants were completely free to decide whether they would participate and undergo the FCE assessment. This avoids the possibility of bias present in cases where claimants are referred to assessments like FCE by IPs. Since the IPs could not refer the claimants for FCE, their positive appraisal of the complementary value of such tests is unlikely to be falsified by their preconceived views.   2. Since a majority of the IPs indicated that they would consider using FCE information in future disability

claim assessments, it may be expected that if they could refer claimants for FCE assessment in appropriate cases, their appreciation this website of the complementary value of FCE information might be even higher.   IPs believe that claimants for whom a discrepancy is found between the subjective complaints and expected objective findings would be a suitable target group for FCE in future disability claim assessments. In these cases, the claimant, who is usually the primary source of information (De Bont et al. 2002), will naturally tend to give a low estimate of their own physical work ability. The findings from physical examination, on the other hand, usually show little or no objective abnormality findings and cannot support the patients’ view of their work ability. Whether this patient group is, indeed, a more suitable group for these forms of assessment why of physical disability cannot be concluded from this study. This would, however, be an interesting topic for future research. Some remarks are necessary about the choice of tests. In our study, we used the full FCE Ergo-Kit. Since the objective was to investigate the complementary value of FCE information for IPs in assessment of the work ability of claimants with MSD, there is no reason to limit the extent of the test battery. It is conceivable, however, that not all information generated by a full FCE may be required in all situations.

[37]. Samples were analysed in duplicate in at least two independent runs. Statistical and data analyses Statistical analysis

of both qPCR and HITChip data was carried out with log-transformed data. In qPCR data, non-detected values were imputed with the half of the theoretical detection limit. For HITChip data, linear models with factors for treatment, health status, time point and breast-feeding with subsequent ANOVA and contrast tests were used to determine the statistical differences between groups. In microarray data, cut-off values for positive responding probes were calculated as described before [28]. In HITChip data the analysed values were summary values on phylum-like and genus-like Mocetinostat price level, Savolitinib purchase obtained by summing the intensities from

all the probes assigned to the respective phylum-like or genus-like phylogetic groups. Totally 19 phylum-like and 78 genus-like level groups reached the detection threshold and were thus used in statistical analysis. The data is presented as mean with standard deviation values. Redundancy analysis (RDA) was performed by using the multivariate statistical analysis package Canoco [38]. RDA plot shows bacterial groups principally contributing to the difference between the groups of subjects. The significance of separation in RDA was assessed by Monte Carlo Permutation Procedure (MCPP [39]). The diversity of the microbial community assessed by HITChip was expressed as Selleckchem Wortmannin Simpson’s reciprocal index of diversity 6-phosphogluconolactonase (1/D) as described before [28, 40]. Results Temporal development of microbiota The faecal microbiota of 34 children at age of 6 and 18 months was analysed using the HITChip phylogenetic microarray. The diversity of total microbiota increased significantly with age, as the Simpson’s the reciprocal diversity index has changed from 78 ± 24 to 111 ± 27 at age

of 6 and 18 months, respectively (p < .001). At the phylum-like level, significant changes in the relative abundances of major bacterial groups were detected (Figure 1). The most prominent decline in abundance was observed for Actinobacteria that contributed 24.2% and 14.1% to the total signal at 6 and 18 months of age, respectively (p= 0.01). Signal intensities for Actinobacteria were almost entirely obtained from bifidobacteria (22.9% of the total microbiota at 6 months and 12.6% at 18 months, p= 0.01). This finding was consistent with quantitative PCR analysis, where total bifidobacteria counts decreased significantly with age (p= 0.03, Additional file 3). At the species level, the amounts of B. longum/infantis group, B. breve, B. bifidum, B. catenulatum group and B. adolescentis decreased over time as assessed by qPCR. In addition to Actinobacteria, the relative abundance of Bacilli decreased with age (from 11.8% to 7.1%, p= 0.03). All genus-like groups belonging to Bacilli decreased, most of which not significantly as individual groups, but the sum effect at the phylum-like level was significant (Figure 1).

Mol Biol Cell 2006,17(1):498–510.PubMedCrossRef 15. Mitrophanov AY,

Groisman EA: Signal integration in bacterial two-component regulatory systems. Genes Dev 2008,22(19):2601–2611.PubMedCrossRef 16. Gunn JS: The Salmonella PmrAB regulon: lipopolysaccharide modifications, antimicrobial peptide resistance and more. Trends Microbiol 2008,16(6):284–290.PubMedCrossRef 17. Mulcahy H, Charron-Mazenod L, Lewenza S: Nec-1s nmr Extracellular DNA chelates cations and induces antibiotic resistance in Pseudomonas aeruginosa biofilms. PLoS Pathog 2008,4(11):e1000213.PubMedCrossRef selleck chemical 18. McPhee JB, Lewenza S, Hancock RE: Cationic antimicrobial peptides activate a two-component regulatory system, PmrA-PmrB, that regulates resistance to polymyxin

B and cationic antimicrobial peptides in Pseudomonas aeruginosa. Mol Microbiol 2003,50(1):205–217.PubMedCrossRef 19. McPhee JB, Bains M, Winsor G, Lewenza S, Kwasnicka A, Brazas MD, Brinkman FS, Hancock RE: Contribution of the PhoP-PhoQ and Quisinostat in vivo PmrA-PmrB two-component regulatory systems to Mg2 + −induced gene regulation in Pseudomonas aeruginosa. J Bacteriol 2006,188(11):3995–4006.PubMedCrossRef 20. Johnson L, Mulcahy H, Kanevets U, Shi Y, Lewenza S: Surface-localized spermidine protects the Pseudomonas aeruginosa outer membrane from antibiotic treatment and oxidative stress. J Bacteriol 2012,194(4):813–826.PubMedCrossRef 21. Petrova OE, Schurr JR, Schurr MJ, Sauer K: The novel Pseudomonas aeruginosa two-component regulator BfmR controls bacteriophage-mediated lysis and DNA release during biofilm development through PhdA. Mol Microbiol 2011,81(3):767–783.PubMedCrossRef 22. Ranasinha C, Assoufi B, Shak S, Christiansen D, Fuchs H, Empey D, Geddes D, Hodson M: Efficacy and safety of short-term administration of aerosolised recombinant human DNase I in adults with stable stage cystic fibrosis. Lancet 1993,342(8865):199–202.PubMedCrossRef 23. Shak S, Capon DJ, Hellmiss R, Marsters SA, Baker CL: Recombinant

human DNase I reduces the viscosity of cystic fibrosis sputum. Proc Natl Acad Sci U S A 1990,87(23):9188–9192.PubMedCrossRef 24. Kim W, Surette MG: Swarming populations of Salmonella Farnesyltransferase represent a unique physiological state coupled to multiple mechanisms of antibiotic resistance. Biol Proced Online 2003, 5:189–196.PubMedCrossRef 25. Ramphal R, Lhermitte M, Filliat M, Roussel P: The binding of anti-pseudomonal antibiotics to macromolecules from cystic fibrosis sputum. J Antimicrob Chemother 1988,22(4):483–490.PubMedCrossRef 26. Chiang WC, Nilsson M, Jensen PO, Hoiby N, Nielsen TE, Givskov M, Tolker-Nielsen T: Extracellular DNA shields against aminoglycosides in Pseudomonas aeruginosa Biofilms. Antimicrob Agents Chemother 2013,57(5):2352–2361.PubMedCrossRef 27. Kim W, Killam T, Sood V, Surette MG: Swarm-cell differentiation in Salmonella enterica serovar typhimurium results in elevated resistance to multiple antibiotics. J Bacteriol 2003,185(10):3111–3117.