In 61 patients, time between last visit and death exceeded 3 years. We cannot determine whether the exclusion of these patients has significantly altered the results. The retrospective design of this study results in some limitations. In a few included patients (n = 25) only 1 reliable VF was available, mainly because the initial VF already showed an advanced visual field defect and therefore those eyes were not retested, or because the patient died shortly after the diagnosis. In all those cases the VF showed a typical glaucomatous defect and the optic disk description was in agreement with the VF appearance. We chose to analyze the rates of low vision and

blindness in all included patients (n = 592). In more than 70% (n = 423) of our study population we had access to patient age, visual acuity, and visual fields as of the time of diagnosis (Data at Diagnosis group), making it possible buy DAPT to calculate the cumulative incidence of blindness from glaucoma in this group only. We had access to the exact date of death, but set the date of blindness to the date of the visit when a patient satisfied blindness criteria. Therefore the time to blindness could have been somewhat overestimated, particularly for patients who had missed many consecutive visits during follow-up. However, the latter was the case

for only 2 unilaterally Anti-diabetic Compound Library research buy blind patients. The proportions of patients with low vision and blindness were similar in the 2 groups, however, with 18.9% bilaterally blind patients in the Follow-up Only group vs 15.4% bilaterally blind patients

in the Data at Diagnosis group. This makes us believe that the results can be generalized for the catchment area, and perhaps to northern Europe. The study population contained predominantly white subjects. Therefore the results cannot be generalized to other ADAMTS5 populations with different ethnicity. In most Western countries approximately 50% of all glaucoma patients are unaware of their disease,17, 18 and 19 and hence many glaucoma patients die unaware of their disease. In Malmö later stages of visual field loss were considerably more common in clinically diagnosed patients than in glaucoma patients identified through population screening.20 It must be considered likely that most glaucoma patients with advanced disease leading to blindness or low vision will seek medical help. Because of these factors, the risks of impairment given here are valid for diagnosed glaucoma patients only; the risk of blindness including undiagnosed patients must be considerably smaller. To our knowledge, there are only 3 published studies analyzing lifetime blindness from OAG. A Finnish study performed by Forsman and associates8 showed results similar to ours but with a smaller sample size. In this study 12% of patients with manifest glaucoma were blind from glaucoma at the time of the last visit, a result that is comparable to ours.

2. The study was designed and performed in accordance with the principles of the Declaration of Helsinki and with Good Clinical Practice mTOR inhibitor Guidelines

established by the International Conference on Harmonization. The study was approved by the Committee for the protection of persons in France (St. Germain en Laye) and discussed at Chad’s National Vaccination Technical Committee before approval by the Ministry of Health in Chad. The head of each participating village provided permission for their village to participate and written informed consent was obtained before enrollment from all participants. All participation was voluntary and no identifying information encoded. The trial was registered at clinicaltrials.org with registry number NCT01559597. A total of 2128 participants residing in 42 villages grouped in 34 clusters

were enrolled in this study (1068 in CTC; 1060 in SCC) (Fig. 1). A total of 952 participants completed the study in each group. The primary ITV analysis included 1830 participants with pre- and post-vaccination antibody level results (913 in CTC; 917 in SCC). The PP population (n = 1563) includes all participants who received click here 2 TT doses 21 to 42 days apart according to the allocated strategy, had blood sampling 21 to 42 days post TT2 and had pre- and post-vaccination serological results. The reasons for exclusion from the PP analysis were an incorrect interval between TT doses and/or blood sampling (n = 240) and receiving TT doses kept in different strategies (n = 27). Baseline

demographics were similar in both arms ( Table 2). Administered CTC vaccines were exposed to temperatures between 21.4 and 38.3 °C (25 ≤ 30 °C during 71.4% of time and ≥30 °C for 20%) for 5 to 27 days with a median of 16 and 14 days for first and second dose (Table 3). Cold chain vaccines were kept between 1.5 and 11.2 °C (<2 or >8 °C for 0.2% of the time). At the time of use, all VVMs indicated that vaccine could be used. At baseline, 272 participants (14.9%), had anti-tetanus IgG levels of <0.16 IU/ml (142 in CTC; 130 in SCC). Among susceptible participants, 95.77% (95%CI = 91.09–98.05) in CTC and 96.15% (95%CI = 91.31–98.35) in SCC had protective antibody levels following two doses of TT (Table see more 4). The upper limit of the 95%CI for the difference in seroconversion was 5.6 in the ITV analysis and 4.4 in the PP analysis. If a protection cutoff of 0.20 IU/ml is used, there were 512 susceptible participants at baseline (259 in CTC; 253 in SCC); the difference in seroconversion was 1.48 (95%CI = −2.8 to 5.7). Following vaccination, overall seroprotection was equal in both groups: 99.34% in the CTC and 99.45% in the SCC groups (Table 4). Pre-vaccination GMC was 0.35 IU/ml in both groups (p = 0.82). After vaccination, GMCs were 1.47 IU/ml (95%CI = 1.40–1.54) in the CTC group and 1.55 IU/ml (95%CI = 1.48–1.62) in the SCC. Inverse cumulative distribution curves of GMCs pre and post-vaccination by group are presented in Fig. 2.

LOXIN forms heterodimers with LOX-1, preventing cell surface localization and function [14] and [15]. To examine the consequence of selective endothelial expression of LOX-1 in atherosclerosis, we used adenoviral gene transfer of LOX-1 in the common carotid artery. We found that overexpression of LOX-1 enhances atherogenesis and that LOXIN inhibits the development of plaque induced by LOX-1 overexpression. Plasmids containing the cDNA for both LOX-1 and

LOXIN were a generous gift from Prof. Giuseppe Novelli. The expression cassette from pCpG-mcs (InvivoGen, San Diego, CA, USA) containing the mCMV enhancer, EF1α promoter, small synthetic intron, and polyA signal was removed by EcoRI digest and cloned into pDC511 (Microbix Biosystems, Canada). The cDNAs for LOX-1 and LOXIN were amplified by PCR using KOD proofreading polymerase with primers SW187F 5′ GCGCAGGCCTCCCGCCATGACTTTTGATGACC, which created a StuI restriction site and optimized the KOZAK Selleckchem Akt inhibitor sequence, and SW188R 5′ CGGCGCTAGCTAAAATGCAGTTTTC, which created a NheI restriction http://www.selleckchem.com/products/BKM-120.html site. The NcoI site within the multiple cloning site of the expression

cassette was removed by digestion, blunting, and relegation, and the amplified cDNAs for LOX-1 and LOXIN cloned in StuI/NheI. Adenoviral vectors were produced using the Microbix Biosystems kit according to their protocols. RAd66 [16], an Ad-null empty virus, was used to control for virus-induced inflammation. All experiments were performed according to home office guidelines and approved by the local ethics committee for animal experimentation. Eight-week-old female ApoE−/− mice were placed on high-fat diet (containing 21% lard and 0.15% cholesterol) 4 weeks prior to gene delivery, to induce hypercholesterolemia and then maintained on high-fat diet for the remainder of the experiment (n=6 per group). Adenoviral

transduction of carotid arteries was performed by luminal incubation of each vector for 10 min without silastic collar placement as described [17] (see Supplementary Information). Viruses were diluted to 1×1010 why pfu/ml using the dialysis buffer used to prepare the adenoviral vector stocks [10 mM Tris (pH 7.5), 135 mM NaCl, 1 mM MgCl2, 10% v/v glycerol], to ensure that all transductions were performed under the same conditions, the vehicle control just contained dialysis buffer. For investigating the effects of LOXIN on LOX-1-induced atherogenesis, 1×1010 pfu/ml of each vector was used (total 2×1010 pfu/ml); hence 2×1010 pfu/ml of the control virus RAd66 was used as a control for this group (labelled RAd66 high). Six weeks following transduction, mice were sacrificed and perfusion fixed with 4% formaldehyde for 5 min. The carotids were exposed, cut longitudinally, and excised before being pinned out flat and fixed for a further 24 h. The fixed arteries were then immobilized in agar, processed, and paraffin embedded so that longitudinal sections of the carotids could be cut.

As fewer children are immunised, so herd immunity (whereby a sufficient proportion of immunised people inhibits disease transmission in a population [23]) is compromised, and people who are not protected (including those who cannot

be immunised for medical reasons) are placed at increased risk of these infections. Outbreaks, particularly of measles, have been recently reported in Europe [24] and the US [25]. There are concerns that the developed world may export measles to developing countries where the infection poses a greater Selleckchem GSK126 risk to health and a greater drain on already scant resources [26]. As measles incidence increases, time passes since the height of the MMR-autism controversy, and the media

becomes increasingly critical of the paper which sparked the controversy [27], it is perhaps no surprise that MMR uptake is improving. Chen’s model of natural fluctuations in vaccine uptake [28] indicates an oscillation whereby as vaccine uptake decreases, disease increases – so in response to this increased disease threat, vaccine uptake increases. By understanding exactly what is changing in parents’ decision-making and harnessing or tapping into those changes, we may expedite this ‘natural’ upturn and more effectively manage any new misconceptions. Qualitative approaches may provide more scope than quantitative population surveys to explore nuanced and novel decision influences, as they allow parents to describe their decision processes without the boundaries set or implied MK-2206 by predefined survey questions.

Previously, qualitative studies of MMR decision-making have identified several themes salient to parents which quantitative work had failed to investigate, highlighting the distinct Thymidine kinase benefits of this approach [10]. In the UK, parents’ MMR decisions have rarely been explored using detailed qualitative methods since uptake of the vaccine started to improve after its lowest point in 2004 [18], and many studies have methodological shortcomings [10]. Ideally, prospective rather than retrospective interviews [29] and [30] should be used to eliminate the risk of consistency bias [31] in which thoughts which were part of the process but which do not fit with the eventual decision are ‘edited out’ of the memory. Further, outcome measures should be drawn from objective official vaccine records rather parental report [9] and [32] to eliminate the possible margin of error around parents’ memory of, awareness of, and willingness to be open about whether and when their child was vaccinated [33], [34] and [35]. Finally, analytic bias [36] should be countered by having more than one analyst work on the data [9], [29] and [30] and employing a “member check” with research participants to ensure that they agree with the interpretation of their interview [37].

0001) less pronounced, as post-challenge Sunitinib in vitro with the homologous

virus A/equine/Otar/764/07 (H3N8). For example, when the animals in the control group were challenged with A/equine/Sydney/2888-8/07 (H3N8), the total score for the clinical symptoms was 27.4 ± 3.5 with duration and 11.6 ± 0.2 days, compared to 36.8 ± 0.8 and 16.3 ± 0.2, respectively for the virus A/equine/Otar/764/07 (H3N8). Neither the prime or booster vaccination did not induced accumulation of detectable antibody titers to the homologous EIV H3N8 in the HAI assay over the entire 12-month observation period (data not shown). In the single vaccinated group, double vaccinated group and control group which were post-challenged at different times PV (up to 12 months),

significant antibody titers against H3N8 were detected in the HAI assay on day 28 post-challenge (Fig. 3 or Supplementary Table 3). The highest antibody titers post-challenge were observed in the double vaccinated group, with significantly (from P = 0.02 to P = 0.0003) higher antibody titers when post-challenged 5 months after the booster vaccination compared to the other single vaccinated and control groups. Here we present new data on the duration of the protective immune response formed in yearlings after prime and booster immunization with a modified live viral vaccine selleck against EIV based on the novel Ca reassortant strain A/HK/Otar/6:2/2010. This vaccine was developed in response to a serious epizootic outbreak of equine influenza A (H3N8) in Kazakhstan in 2007 [19], when approximately 200,000 horses became ill, of which 50,000 horses – including 40,000 foals – died. Strain A/equine/Otar/764/2007 Cytidine deaminase (H3N8)

was isolated from the epizootic outbreak and subsequently used to generate the Ca vaccine strain A/HK/Otar/6:2/2010. Phylogenetic analysis of the HA gene of A/equine/Otar/764/2007 (H3N8) demonstrated that this strain belongs to the American Lineage Florida Clade 2 and has 99.99% homology to the strain A/equine/Richmond/1/2007 (H3N8) [18], which was recommended by the Office International des Epizooties for the production of a vaccine against EIV [20]. One objective of this study was to investigate the safety of our vaccine in yearlings. Both single and double intranasal administration of the live vaccine were harmless to yearlings, as no clinical signs of disease were observed in any animal during the observation period, and viral shedding only occurred at low titers and in less than in 50% of the animals. These results are consistent with our earlier studies [16] and [17], which demonstrated that the reassortant Ca strain A/HK/Otar/6:2/2010 could only replicate in the upper respiratory organs and did not induce any clinical manifestation of EIV (or even of a generalized infectious process) in yearlings or pregnant mares.

The epithelial cell that supports viral genome amplification, therefore, is subject to differentiation signals and can express well-defined markers of differentiation such as keratins 1 and 10 (cutaneous epithelia) or 4 and 13 (mucosa), while at the same time expressing markers of cell cycle entry, such as MCM, Ki-67, PCNA, CyclinE and CyclinA. Careful analysis suggests that, in the case of the low-risk HPV types, genome amplification begins as the infected cell undergoes cell cycle reactivation in the mid- to upper epithelial layers and enters an S phase-like

state. For the high-risk types, this S phase-like state marks the upper proliferative layers within the neoplasia, rather than a region where cell cycle re-entry has occurred. HPV genome amplification persists as the ‘differentiating’ Linsitinib nmr cell moves from an S-like to a G2-like phase, with viral genome amplification occurring primarily in G2 after cellular DNA replication has been completed this website [131] and [132]. Laser capture experiments in animal models

have shown at least a 2-log increase in viral copy number per cell during the genome amplification phase [95]. In addition to E1 and E2, it is thought that the E4 and E5 proteins contribute indirectly to genome amplification success by modifying the cellular environment, with E5 also being involved in koilocyte formation [133]. E5 is a three-pass transmembrane protein with a cytoplasmic C-terminus [134]. It is believed to possess pore-forming capability and interferes with apoptosis [135] and the intracellular trafficking of endocytotic vesicles [136] and [137]. GPX6 E5 is also thought to make an important contribution to genome amplification success through its ability to stabilize EGFR and to enhance EGF signalling and MAP Kinase activity [138], [139], [140] and [141] and to modulate both ERK 1/2 and p38 independently of EGFR [142] and [143]. The MAP Kinases ERK 1/2 are critical

modulators of nuclear E1 accumulation through the phosphorylation and activation of the nuclear localisation signal within the E1 protein, and their activity is dependent on upstream MAPKs MEK 1/2 and p38. Through both the S and G2-like phases, the accumulation of Cyclins E and A and their associated cyclin-dependent kinase cdk2 further contributes by phosphorylation and inhibition of an E1 nuclear export sequence [144] and [145]. Recent work has suggested that other post-translational modifications in E1 (e.g., cleavage by caspases) also facilitate differentiation-dependent genome amplification, and that the accumulation of E1 in the nucleus may in itself enhance viral DNA replication at the expense of cellular replication through induction of a DNA damage response [146].

Given that PRV is an oral vaccine, these results likely reflect that, in developing countries, oral vaccines have a history of being less immunogenic than in the developed world. These differences of oral vaccines have been

postulated due to differences in the level of transplacentally acquired maternal antibody, immune and non-immune components of breast milk, the amount of gastric acid in the digestive tract, micronutrient malnutrition, interfering gut flora, and diarrheal and immune system disease [15], [27], [28] and [29]. In the case of Bangladesh versus Vietnam, the reasons for the decreased CAL 101 immunogenicity of PRV in Bangladeshi infants may be due to a combination of the differences in host populations and their associated health conditions, which include malnutrition Alisertib and concomitant infections of the gut with several enteropathogens. In addition, the PD3 anti-rotavirus IgA GMT levels were also reduced in Asian subjects when compared to those of subjects in developed world

countries [12], [13], [18], [21], [22], [23] and [24]. The GMT (69.3 dilution units/mL) of the serum anti-rotavirus IgA at PD3 of Asian subjects was approximately 2-fold lower than those measured 14 or 42 days after Dose 3 in subjects in developed countries. However, once again, the pattern was not the same when the two countries were evaluated separately. The GMT level of the serum anti-rotavirus

IgA at PD3 of Bangladeshi subjects was 29.1 dilution units/mL, approximately 5- to 10-fold lower than those measured 14 or 42 days after Dose 3 in subjects in developed countries, while the PD3 GMT level of the serum IgA in Vietnamese subjects (158.5 dilution units/mL) was approximately the same as those measured 14 or 42 days after Dose 3 in subjects in the EU and Latin America [21] and [24]. The clinical significance of these observations is not understood because an immune correlate of Sodium butyrate protection has not been established. SNA responses to each of the five human serotypes, G1, G2, G3, G4, and P1A[8], contained in PRV were also evaluated at pD1 and PD3 in Asian subjects. The results showed a ≥3-fold rise in SNA responses to rotavirus serotypes G1, G2, G3, G4 and P1A[8] in varying percentages in the Asian subjects. A consistent and similar pattern was observed when the data from Bangladesh and Vietnam were compared to those of the African subjects [25] and [26]. For serotypes G1, G2, G3, G4, and P1A[8], the ≥3-fold SNA response rates in Bangladeshi subjects were approximately 50, 30, 10, 35, and 40 percentage points, respectively, lower than those exhibited by subjects in the US, EU, Taiwan, Korea, and Latin America [12], [13], [18], [21], [22], [23] and [24].

The majority of baseline TIgG seropositive subjects displayed antibody levels near the assay cut-off (data not shown), whereas post-vaccine levels were substantially higher in virtually all subjects. The low baseline seropositivity rates with both the cLIA and PsV NAb assays suggest that the high proportion of TIgG antibodies detected at baseline reflects low specificity of the TIgG assay, or cross-reactivity with other HPV types, such as those associated with cutaneous warts which are commonly acquired in childhood [24]. Safaeian et al. [25] observed a high HPV 16 baseline seropositive rate among 18–25-year-old women tested with the Glaxo-Smith-Kline Linsitinib HPV

16 EIA compared to the cLIA and a PsV NAb assay, and noted that agreement between the cLIA and the EIA was improved by raising the cut-off of the EIA. Brown et al. suggested that the high specificity

Selleckchem SB203580 of the cLIA may make it a more suitable assay for classifying baseline seropositivity, whereas the TIgG assay detects a broader array of HPV antibodies with high sensitivity and may be more suitable for serological follow-up of vaccinated subjects over time [15]. A modest upward adjustment of the TIgG assay cut-off would considerably reduce the number of individuals we identified as seropositive at baseline, but such an adjustment would require verification that the sensitivity of the assay for assessing post-vaccine responses would not be compromised. We demonstrated that the PsV NAb assay sensitivity can be increased by determining partial neutralization endpoints. Both NT90 and NTpartial endpoints consistently yield 2- to 8-fold higher GMTs than NT100. While only 85–86% of subjects remained seropositive for HPV 18 at 36 months by both cLIA and PsV NAb (NT100 endpoint) assays, all subjects had detectable HPV 18 neutralizing antibodies at the NTpartial endpoint. Thus, we conclude that the PsV NAb assay is more sensitive than the cLIA for detection

of anti-HPV 18. The PsV NAb assay is labour-intensive and not suitable for large-scale analyses, but it can serve nearly as a useful supplementary assay. While the determination of the PsV NAb endpoints may have a subjective component, we found that the assay is reproducible over multiple test batches and between operators (data not shown). Month 7 sera were initially tested together with baseline sera, and were later re-tested together with the 18-, 24- and 36-month sera. In nearly all cases, month 7 GMTs varied by no more than one dilution between test runs. This study has some limitations. All PsV NAb assays for this report were performed with single lots of HPV 16 and 18 PsV. PsV NAb titres could be affected by variable inter-batch packaging efficiency of the RFP reporter plasmid but GMTs can be consistently derived by calibration of PsV batches using standard sera [26] and [27].

Result of the present study suggest a significant decrease in the all the efficacy parameters (p < 0.05) concluding that the drug combination is effective in decreasing the blood pressure and LDL-C levels. The safety parameters were assessed by concentrating on the adverse drug event during the 4 visits. The laboratory investigations have shown that, there is no increase in the SGOT, SGPT, serum creatinine and serum electrolytes. No serious and investigational adverse events were reported. In this study, it is observed that the fixed dose combination pill showed 100%

compliance. It can be concluded by calculating the difference between 28 tablets of therapy for 28 days and comparing with number of Selleckchem PD173074 tablets left in the container. Therefore, the drug combination Lisinopril (5 mg), Simvastatin (10 mg) and Aspirin (75 mg) and Hydrochlorothiazide learn more (12.5 mg) was found to have maximum safety with minimum adverse events reported, which is helpful in treatment of patients with hypertension and dyslipidemia or coronary artery diseases. Fixed dose combination of Simvastatin, Aspirin, Hydrochlorothiazide

and Lisinopril results in lowering blood pressure and cholesterol levels and improved adherence in patients with at least one Cardiovascular risk factor such as Hypertension and Dyslipidemia or Coronary Artery Disease. The use of single pill could well encourage patients to adhere to treatments as well as seriously reduce the cost of the drugs. All authors have none to declare. “
“Spray drying as one of the method of drying is highly utilized and acceptable method of drying and gained lot attention in past couple of decades. Spray drying is defined as atomization of solution of one or more solids via nozzle, spinning disc or other device followed by evaporation of solvent to obtain dried particles. Choosing optimum parameter such as inlet temperature, outlet temperature, feed Ketanserin transfer

rate, atomization rate and D-block on and off for spray drying is difficult and most important step in whole operation. Once these parameters are optimized for particular type of product, spray drying becomes easy.1, 2, 3, 4 and 5 Budesonide is a glucocorticoid steroid for the treatment of Crohn’s disease (inflammatory bowel disease). Budesonide has a high first-pass metabolism. Budesonide has a lower incidence of systemic manifestations than similar medications.6, 7 and 8 Targeted drug delivery into the colon is highly desirable for local treatment of a variety of bowel diseases such as ulcerative colitis, Crohn’s disease, amebiasis, colonic cancer, local treatment of colonic pathologies, and systemic delivery of protein and peptide drugs. The colon specific drug delivery system (CDDS) should be capable of protecting the drug.

[Teratogenicity information is readily available from the DART database [450] and Motherisk, www.motherisk.org.] The adverse effects of atenolol Selleck cancer metabolism inhibitor on fetal growth have been particularly associated with use from early pregnancy [354],

[355], [356], [357] and [358]. Whether or when to replace ACE inhibitors, angiotensin-receptor blockers (ARBs), atenolol, or less commonly used antihypertensives pre-pregnancy or when pregnancy is diagnosed, and if so, with what is uncertain, but the following should be considered: If ACE inhibitors and ARBs are being given for renoprotection, no equivalent agent is available for use in pregnancy; however, much of ACE/ARB-related renoprotection is provided lowering BP, achievable by alternatives [7]. Normally, conception may take up to 12 months, check details but women over 30 years have a higher incidence of subfertility. If an ACE inhibitor is discontinued

pre-pregnancy in a woman with renal disease, yet conception does not occur after 12 months and proteinuria is rising despite excellent BP control (i.e., <140/90 mmHg), it may be prudent to reinstate ACE inhibition, perform monthly pregnancy tests, and proceed with investigations of subfertility. A multidisciplinary approach towards comorbidities and/or cardiovascular risk factors is recommended. Although existing data are reassuring about use of statins in pregnancy, they should be discontinued pre-pregnancy or as soon as pregnancy is diagnosed until further data are available.

Information about safety with treatment at 240–336 weeks will come from the StAmP Trial (ISRCTN 23410175). For information on management of renal disease in pregnancy, see the update by Davison [451]. 1. MgSO4 is recommended for first-line treatment of eclampsia (I-A; High/Strong). For eclampsia, MgSO4 more than halves recurrent seizure rates compared with phenytoin [452], diazepam [453], or a lytic cocktail [454]. Also, MgSO4 (vs. diazepam) reduces maternal death; benzodiazepines should not be used for seizure termination. Loading is with MgSO4 4 g IV (or 5 g in South Africa) over 5 min, followed by infusion of 1 g/h. Treatment of any recurrent seizures is with another 2–4 g IV over 5 min. Serum Mg2+ levels are unnecessary, with women followed clinically for adverse Mg2+-related effects. In women mafosfamide with preeclampsia, MgSO4 (vs. placebo or no therapy) more than halves eclampsia occurrence (RR 0.41; 95% CI 0.29–0.58) [455] and [456]. Loading is with MgSO4 4 g IV over 10–15 min, followed by infusion of 1 g/h. The NNT (95% CI) to prevent one seizure is 50 (34–100) with severe preeclampsia and 100 (100–500) with non-severe preeclampsia. MgSO4 decreases abruption risk (RR 0.64; 95% CI 0.50–0.83; NNT 100 [50–1000]) but increases Caesarean delivery (RR 1.05; 95% CI 1.01–1.10) and side effects (RR 5.26; 95% CI 4.59– 6.03). MgSO4 (vs. phenytoin) reduces eclampsia (RR 0.08; 95% CI 0.01–0.60) but increases Caesarean delivery (RR 1.21; 95% CI 1.